View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21592_low_4 (Length: 445)
Name: NF21592_low_4
Description: NF21592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21592_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 21 - 347
Target Start/End: Complemental strand, 2161113 - 2160791
Alignment:
| Q |
21 |
cttgaaacattataaagtgcaagtttgtgaaggagattccaagattccctcgtttgtgcagcatcagggaaacgatagaaacatgtaaagtgtcatccag |
120 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161113 |
cttgaaacattatcaagtgcaagtttgtgaaggagattccaagattcactcgtttgtgcagcatcagggaaacgatagaaacatgtaaagtgtcatccag |
2161014 |
T |
|
| Q |
121 |
gtcaataaaatttgatgagtgccattgtagcgaccattcaaaacccaccaattcttctcattctgtcaagtgcaaatgctgcatcgaatccgaatcccaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161013 |
gtcaataaaatttgatgagtgccattgtagcgaccattcaaaacccaccgattcttctcattctgtcaagtgcaaatgctgcatcgaatccgaatcccaa |
2160914 |
T |
|
| Q |
221 |
actcaaccttatctcctcaattttgctggcatataccaaagtctcacacacaaaaatactcccagttggtacgtccaaatgaggtcttgggctacccacc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
2160913 |
actcaaccttatctcctcaattttgctggcatataccaaagtctcacacacaaaaatactcccagttggtacgtccaaatgaggtcttgggtt----acc |
2160818 |
T |
|
| Q |
321 |
caaatccggaagctccagctggaaaaa |
347 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2160817 |
caaatccggaagctccagctggaaaaa |
2160791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 342 - 432
Target Start/End: Complemental strand, 2160748 - 2160658
Alignment:
| Q |
342 |
gaaaaatactcaccattctgattttgtaatgccctcaatgaatttcttatgttgctatatgggttaggtgtctctcattattgtgcctttg |
432 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2160748 |
gaaaaatactcaccattctggttttgtaatgccctcaatgaatttcttatgttgctatatgggttaggtgtctatcattattgtgcctttg |
2160658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University