View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21593_high_7 (Length: 333)
Name: NF21593_high_7
Description: NF21593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21593_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 7 - 318
Target Start/End: Complemental strand, 47192335 - 47192024
Alignment:
| Q |
7 |
gtaatacccaaggtgatggccaatagacactagataacaaaggacttttgaatagaagacgaagagcattgtcgttgtcgaaataaaacttatagaaacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192335 |
gtaatacccaaggtgatggccaatagacactagataacaaaggacttttgaatagaagacgaagagcattgtcgttgtcgaaataaaacttatagaaacc |
47192236 |
T |
|
| Q |
107 |
tgaggaatagtttgtttcacttttggatgaaactaaggttgctcgctcattaatttcttggccaggaagaagagtatctgttggaaaatcaaagctttgc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192235 |
tgaggaatagtttgtttcacttttggatgaaactaaggttgctcgctcattaatttcttggccaggaagaagagtatctgttggaaaatcaaagctttgc |
47192136 |
T |
|
| Q |
207 |
caaaggatactaatgttaccgttggtcgtggcgagaacgaggttgccattgttttgaagcttgagctgtaatggaaaaggagaaaaggatgaagtggacc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192135 |
caaaggatactaatgttaccgttggtcgtggagagaacgaggttgccattgttttgaagcttgagctgtaatggaaaaggagaaaaggatgaagtggacc |
47192036 |
T |
|
| Q |
307 |
aaattggtgttc |
318 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47192035 |
aaattggtgttc |
47192024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 26693303 - 26693264
Alignment:
| Q |
169 |
caggaagaagagtatctgttggaaaatcaaagctttgcca |
208 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
26693303 |
caggaaggagggtatctgttggaaaatcaaagctttgcca |
26693264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University