View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21593_high_9 (Length: 286)
Name: NF21593_high_9
Description: NF21593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21593_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 6454118 - 6454254
Alignment:
| Q |
18 |
agtctctggaaaaattaattcatctctgtgttatattnnnnnnntgcaattctttaaatcaaccctagttggatcctactaaaagggtacctcgaaaaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454118 |
agtctctggaaaaattaattcatctctgtgttatattaaaaaaatgcaattctttaaatcaaccctagttggatcctactaaaagggtacctcgaaaaca |
6454217 |
T |
|
| Q |
118 |
atgcaaatcatgactcactcatgatcatataatcact |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454218 |
atgcaaatcatgactcactcatgatcatataatcact |
6454254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 214 - 276
Target Start/End: Original strand, 6454314 - 6454376
Alignment:
| Q |
214 |
agtactctatactataccctaattaaatcacatcctaaaatgcatactttattttcacctttg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454314 |
agtactctatactataccctaattaaatcacatcctaaaatgcatactttattttcacctttg |
6454376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University