View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21594_high_15 (Length: 237)
Name: NF21594_high_15
Description: NF21594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21594_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12555143 - 12554921
Alignment:
| Q |
1 |
tctataattcagggaaaatcggcatgcagcacaagtattaatctcaggaggcgagctatgaccagggtaatcatattgtatttccttcagaatcttgcaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12555143 |
tctataattcaaggaaaatcggcatgcaacacaagtattaatctcaggaggcgagctatgaccagggtaattatattgtatttccttcagaatcttgcaa |
12555044 |
T |
 |
| Q |
101 |
cgcgacctttggagccagcaacacgattcaatgcgaggctgatcctaagagttctctctaaactcgcaacacgcaggtggtagcatgcgccgttagtgat |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12555043 |
cgcgacctttggagccagcaacgcgattcaatgcgaggctgatcctaagagttctctctaaactcgcaacacgcatgtggtagcacgcgccgttagtgat |
12554944 |
T |
 |
| Q |
201 |
gacaagattgaatcttacttatt |
223 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
12554943 |
gacgagattgaatcttacttatt |
12554921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University