View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21594_high_15 (Length: 237)

Name: NF21594_high_15
Description: NF21594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21594_high_15
NF21594_high_15
[»] chr5 (1 HSPs)
chr5 (1-223)||(12554921-12555143)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12555143 - 12554921
Alignment:
1 tctataattcagggaaaatcggcatgcagcacaagtattaatctcaggaggcgagctatgaccagggtaatcatattgtatttccttcagaatcttgcaa 100  Q
    ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
12555143 tctataattcaaggaaaatcggcatgcaacacaagtattaatctcaggaggcgagctatgaccagggtaattatattgtatttccttcagaatcttgcaa 12555044  T
101 cgcgacctttggagccagcaacacgattcaatgcgaggctgatcctaagagttctctctaaactcgcaacacgcaggtggtagcatgcgccgttagtgat 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||    
12555043 cgcgacctttggagccagcaacgcgattcaatgcgaggctgatcctaagagttctctctaaactcgcaacacgcatgtggtagcacgcgccgttagtgat 12554944  T
201 gacaagattgaatcttacttatt 223  Q
    ||| |||||||||||||||||||    
12554943 gacgagattgaatcttacttatt 12554921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University