View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21594_high_3 (Length: 459)
Name: NF21594_high_3
Description: NF21594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21594_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 12 - 441
Target Start/End: Original strand, 13749573 - 13750002
Alignment:
| Q |
12 |
agagaggaattggagctagcctcaaagcgcacttttacagtctcctgtaacaactgcaagtcctgtatctgttgagtcaatcgaccctcatcttcttcca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13749573 |
agagaggaattggagctagcctcaaagcgcacttttacagtctcctgtaacaactgcaagtcctgtatctgttgagtcaattgaccctcatcttcttcca |
13749672 |
T |
 |
| Q |
112 |
ggtcctttctctcttctacactttttacatctcttttcacccttggctctttggatttgctctgatcatattcgaactcattcatgagagagcctaattt |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13749673 |
ggtcctttctctcctctacactttttacatctcttttgacccttggctctttggatttgctctgatcatattcgaactcattcatgagagagcctaattt |
13749772 |
T |
 |
| Q |
212 |
ggccttagcatcttttatccttttggattcaattttggtttcatgaactgacctttcctgtttctcttgcaattgttctaatgtctcttggcatgattta |
311 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
13749773 |
ggccttggcatcttttatccttttggattcaattttggtttcatcaactgacctttcctgtttctcttgcaattgttctattgcctcttggcatgattta |
13749872 |
T |
 |
| Q |
312 |
agagcagcttctgccatcaaacggcgcgcttcatcgtcttcgataacgataccttctccgagttcatcttgcagaacagaaactctctcttgtaattcct |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13749873 |
agagcagcttctgccatcaaacggcgcgcttcatcgtcttcgataacgataccttctccgagttcatcttgcagaacagaaactttctcttgtaattcct |
13749972 |
T |
 |
| Q |
412 |
tgatcttatcttcagtttcccagtacctag |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13749973 |
tgatcttatcttcagtttcccagtacctag |
13750002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 337
Target Start/End: Original strand, 28753394 - 28753463
Alignment:
| Q |
268 |
cctgtttctcttgcaattgttctaatgtctcttggcatgatttaagagcagcttctgccatcaaacggcg |
337 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
28753394 |
cctgtttctcttgcaaacgtgacaatgtttcttggcacgatttaagagccgcttctgccatcaaacggcg |
28753463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University