View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21594_low_12 (Length: 324)
Name: NF21594_low_12
Description: NF21594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21594_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 69 - 199
Target Start/End: Complemental strand, 28479686 - 28479555
Alignment:
| Q |
69 |
gtggcactgtcaaatttggcacatatgaaagtatactatcacacattttggcataattcattgctt-agtgtgagttgacgtaaaaggctccttaattaa |
167 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||| ||||||||||||||||||| ||||||| | ||||||||||| || |||||||||||||||| |
|
|
| T |
28479686 |
gtggcactgtcaaatttggggcataagacagtatactaccacacattttggcataatttattgcttcaatgtgagttgacctagaaggctccttaattaa |
28479587 |
T |
|
| Q |
168 |
gctaactgaaccatattgaaatattgtggcct |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
28479586 |
gctaactgaaccataatgaaatattgtggcct |
28479555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 197 - 285
Target Start/End: Complemental strand, 28479007 - 28478918
Alignment:
| Q |
197 |
ccttctttatgagactcttg-caatttcttctggacgaaaaagtatgtcagcatttggatttcgataaaacatcaattcaggttttccat |
285 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||| ||||||||||||||| | ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
28479007 |
ccttttttatgagactcttgtcaatttcttctgaacggaaaagtatgtcagcactaggatttcgataaaacatgaattcaggtttcccat |
28478918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University