View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21596_high_1 (Length: 247)
Name: NF21596_high_1
Description: NF21596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21596_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 43610191 - 43609951
Alignment:
| Q |
1 |
atgaggatttgctttgttattttttgtattgtttcattgatccacttttgtcgtgctgaaccattatcggttgatggtaaggtattgatactcgatgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43610191 |
atgaggatttgctttgttattttttgtattgtttcattgatccacttttgtcgtgctgaaccattatcggttgatggaaaggtattgatactcgatgaat |
43610092 |
T |
|
| Q |
101 |
ccaacttcgattccgccatttcatccttcgatcacatcttggttgatttctacgctccttggtgtggtcactgcaagcgtctctctcctgaggtatatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43610091 |
ccaacttcgattccgccatttcatccttcgatcacatcttggttgatttctacgctccttggtgtggtcactgcaagcgtctctctcctgaggtatatat |
43609992 |
T |
|
| Q |
201 |
cttatggctctttctaaatatttgatttttattcataccca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43609991 |
cttatggctctttctaaatatttgatttttattcataccca |
43609951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University