View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21596_high_2 (Length: 227)
Name: NF21596_high_2
Description: NF21596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21596_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 66 - 205
Target Start/End: Original strand, 33817271 - 33817410
Alignment:
| Q |
66 |
tatcaatggtacccaacatggttacttttaagtgtactttaagtgtactcgcttttctatcttgcagaagaagtgttgagcaggggcatttctaaaccgg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
33817271 |
tatcaatggtacccaacatggttacttttaagtgtactttaagtgtactcgcttttctatcttgcagaagaagtgttgagcacgggcatttctaaactgg |
33817370 |
T |
 |
| Q |
166 |
tggataatggtgatttagagttgatgtcaagcactagaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817371 |
tggataatggtgatttagagttgatgtcaagcactagaag |
33817410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 33817229 - 33817159
Alignment:
| Q |
1 |
attacgggaagttgcattaaaaccaaactttgttaaaacttcaatcaacaaactccattctaatgtatcaa |
71 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33817229 |
attacgggaagttgtactaaaaccaaactttgttaaaacttcaatcaaaaaactccattctaatgtatcaa |
33817159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University