View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21598_low_3 (Length: 274)
Name: NF21598_low_3
Description: NF21598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21598_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 6032421 - 6032675
Alignment:
| Q |
1 |
gaagatttgaaagaaaaatatcctgaaattgatcaaaatcaacaaatccttcatcaattgatgcctaatgaagatgaaacttcaaaatcacttcaaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032421 |
gaagatttgaaagaaaaatatcctgaaattgatcaaaatcaacaaatccttcatcaattgatgcctaatgaagatgaaacttcaaaatcacttcaaagag |
6032520 |
T |
 |
| Q |
101 |
atgatatctttaacttcattgaggaatctattgtgattaagagaaagttgaagaaatcttcttctcatcattatcaacaaaacactaatttgatccctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032521 |
atgatatctttaacttcattgaggaatctattgtgattaagagaaagttgaagaaatcttcttctcatcattatcaacaaaacactaatttgatccctaa |
6032620 |
T |
 |
| Q |
201 |
ggaagctagttttgatcatgactctccaatgttatcaccaaattgggatgctaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032621 |
ggaagctagttttgatcatgactctccaatgttatcaccaaattgggatgctaat |
6032675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University