View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21599_high_8 (Length: 252)

Name: NF21599_high_8
Description: NF21599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21599_high_8
NF21599_high_8
[»] chr1 (1 HSPs)
chr1 (77-170)||(19415998-19416091)


Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 77 - 170
Target Start/End: Complemental strand, 19416091 - 19415998
Alignment:
77 tgtttgtgggacggtggcctttagtggttcccgttctagctccacccctgctataaacaagcgttttgcatcaatcttgtatacttcatgtcat 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19416091 tgtttgtgggacggtggcctttagtggttcccgttctagctccacccctgctataaacaagcgttttgcatcaatcttgtatacttcatgtcat 19415998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University