View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21599_high_8 (Length: 252)
Name: NF21599_high_8
Description: NF21599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21599_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 77 - 170
Target Start/End: Complemental strand, 19416091 - 19415998
Alignment:
| Q |
77 |
tgtttgtgggacggtggcctttagtggttcccgttctagctccacccctgctataaacaagcgttttgcatcaatcttgtatacttcatgtcat |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19416091 |
tgtttgtgggacggtggcctttagtggttcccgttctagctccacccctgctataaacaagcgttttgcatcaatcttgtatacttcatgtcat |
19415998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University