View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21599_low_11 (Length: 237)
Name: NF21599_low_11
Description: NF21599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21599_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 48492101 - 48491880
Alignment:
| Q |
1 |
aaggtaccactattttggggaataactgctgatggatatgcagcattttctgatgatgctgaattgcttaaaagtgcttgtggaaagtcacttgcttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48492101 |
aaggtaccactattttggggaataactgctgatggatatgcagcatttgctgatgatgccgaattgcttaaaagtgcttgtggaaagtcacttgcttctt |
48492002 |
T |
|
| Q |
101 |
tccctcaaggtacaataacttcttctatcatggaaattagtccatttgagtcaaaacttgcttcagctcgactttatttgataagaatttgtcctgctcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48492001 |
tccctcaaggtacaataacttcttctatcatggaaattagtccatttgagtcaaaacttgcttcagctcgactttatttgataagaatttgtcctgctcg |
48491902 |
T |
|
| Q |
201 |
gactcaagtttgacatgaacat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48491901 |
gactcaagtttgacatgaacat |
48491880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 7795210 - 7795320
Alignment:
| Q |
1 |
aaggtaccactattttggggaataactgctgatggatatgcagcattttctgatgatgctgaattgcttaaaagtgcttgtggaaagtcacttgcttctt |
100 |
Q |
| |
|
||||| || |||| ||||||||||||||||||||| |||| ||| ||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7795210 |
aaggttcctctatattggggaataactgctgatggctatgtagcctttgctgatgatgctgatttgcttaaaggtgcttgtggaaagtcacttgcttctt |
7795309 |
T |
|
| Q |
101 |
tccctcaaggt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
7795310 |
tccctcaaggt |
7795320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University