View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2159_high_19 (Length: 233)
Name: NF2159_high_19
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2159_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 31262812 - 31262609
Alignment:
| Q |
16 |
tttactatacgcaacactttgattccttctttttcgagttttaaccggaaactcttgttaccaacacgtggaccgccgaatgagattaccgttactaacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262812 |
tttactatacgcaacactttgattccttctttttcgagttttaaccggaaactcttgttaccaacacgtggaccgccgaatgagattaccgttactaacg |
31262713 |
T |
 |
| Q |
116 |
gtttctgatcaaaatatgtttttatatcatgcgcagttaaaattgctaatgctgctcctaaactgtgtcctgttatagtaaaactcaaattttcaccttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262712 |
gtttctgatcaaaatatgtttttatatcatgcgcggttaaaattgctaatgctgctcctaaactgtgtcctgttatagtaaaactcaaattttcaccttt |
31262613 |
T |
 |
| Q |
216 |
atat |
219 |
Q |
| |
|
|||| |
|
|
| T |
31262612 |
atat |
31262609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University