View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2159_high_20 (Length: 227)
Name: NF2159_high_20
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2159_high_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 227
Target Start/End: Original strand, 32981860 - 32982077
Alignment:
| Q |
8 |
tgttaatatgaccctacataatataggtgatcaaacattcttaatgaatcacaattttgggtggagtcgtggagatgtgtacaatctctatttgtagatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32981860 |
tgttaatatgaccctacataatataggtgatcaaacattcttaatgaatcacgattttgggtggagtcgtggagatgtgtacaatctccctttgtagatt |
32981959 |
T |
 |
| Q |
108 |
gattaattatccgttgttgctctcgataccagtcgcccaaaatatcaatcatagcacaacatgatgattcttatgatcaatattgatcatacataggttt |
207 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32981960 |
gattaattattcgttgttgctctcaatac--ttcgcccaaaatatcaatcatagcagaacatgttgattcttatgatcaatattgatcatacataggttt |
32982057 |
T |
 |
| Q |
208 |
tgatgattagcatgttaatt |
227 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
32982058 |
tgatgattagtatgttaatt |
32982077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University