View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2159_high_21 (Length: 223)
Name: NF2159_high_21
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2159_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 28799878 - 28800068
Alignment:
| Q |
15 |
cataggagattgtgttgggtgaattggaggagggtttatcaaccgaagaaaaagggtggtttgggggtgacagatgtgaagttggtgaatcttagccttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28799878 |
cataggagattgtgttgggtgaattggaggaggggttatcaaccgaagaaaaagggtggtatgggggtgacaaatgtgaagttggtgaatcttagccttt |
28799977 |
T |
 |
| Q |
115 |
taacaaagtggaaatggaagatttttaaggaagatggctccttgtggaagagggtgcttgaagataaataaggtgaagggttgggtgattt |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28799978 |
taacaaagtggaaatggaagctttttaaggaagatggttccttgtggaagagggtgcttgaagataaatacggtaaagggttgggtgattt |
28800068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 72 - 184
Target Start/End: Complemental strand, 23294190 - 23294078
Alignment:
| Q |
72 |
ggtttgggggtgacagatgtgaagttggtgaatcttagccttttaacaaagtggaaatggaagatttttaaggaagatggctccttgtggaagagggtgc |
171 |
Q |
| |
|
|||||||| || | ||||||||||||| |||||||||||||| | |||| ||||| |||||| || ||||| ||||| || |||||||||||||||| |
|
|
| T |
23294190 |
ggtttgggagttagagatgtgaagttgatgaatcttagccttcttgcaaaatggaagtggaagcttcataagggtgatggttctttgtggaagagggtgc |
23294091 |
T |
 |
| Q |
172 |
ttgaagataaata |
184 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23294090 |
ttgaagataaata |
23294078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 131
Target Start/End: Complemental strand, 32775225 - 32775181
Alignment:
| Q |
87 |
gatgtgaagttggtgaatcttagccttttaacaaagtggaaatgg |
131 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
32775225 |
gatgtgaagttggtgaatttgagccttttggcaaagtggaaatgg |
32775181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University