View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2159_high_23 (Length: 203)
Name: NF2159_high_23
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2159_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 33885117 - 33885285
Alignment:
| Q |
19 |
atggattaacaattgtattagagtgttcaactcaataatatgttacaatgttttcctcatctttgatcttcttgatgctgttttatgtgttatctataga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885117 |
atggattaacaattgtattagagtgttcaactcaataatatgttacattgttttcctcatctttgatcttcttgatgctgttttatgtgttatctataga |
33885216 |
T |
 |
| Q |
119 |
taccttgatgaacgcattgatggggtggcctcttcttgttgttgctctaaatgggagatacagaagaag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33885217 |
taccttgatgaacgcattgatggggtggcctcttcttgttgttgctctaaatgggagagacagaagaag |
33885285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University