View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2159_high_3 (Length: 502)
Name: NF2159_high_3
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2159_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 15 - 417
Target Start/End: Complemental strand, 24291278 - 24290887
Alignment:
| Q |
15 |
attttaaggtatctaggttcgttattgttaattgtggttttgttagaagctatacttcgactaccaaacttgcagatagttgcagaaaaatgttgcttat |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24291278 |
attttaaggtatctaggttccttattgttaattgtggctttattagcagctatacttcgactaccaaacttgcagatagttgcagtgaaatgttgcttat |
24291179 |
T |
 |
| Q |
115 |
gtgactgattgctattgcagttgcagaggcatttaaaaatataatttttgtgattaacaaatgttgtgaattgaatttaatatcatatcatatttctcct |
214 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
24291178 |
gtgactgactgccattgcagttgcagaggcatttaaaaatataatttttgtgatc-------gttgtgaattgaacttaaaatcataa-----ttctcct |
24291091 |
T |
 |
| Q |
215 |
atcaatggagaaagaagagttgtcaaaaaattctcatttaggttcgatatcccagattctcaagcaagtgactgatcgtgtttattttctttgtagcact |
314 |
Q |
| |
|
|||||| ||||||||||| ||||||||| || |||||||||||| |||| ||||||||||||||| ||| ||| |||||||||||| |||||||||| |
|
|
| T |
24291090 |
atcaatagagaaagaagaattgtcaaaacgttttcatttaggttctgtatcacagattctcaagcaaacgaccgattgtgtttattttcattgtagcact |
24290991 |
T |
 |
| Q |
315 |
gcttgtttggtgggcattacaggcgtttttgctccacttcttgaggagacagtttt-cgaggcttttttatgatgtccctatctaaatggtattgattgt |
413 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
24290990 |
gcttgtttggtgggcatcacaggcgtttttgctccacttcttgaggagacagttttccgaggcttttttatgacgtccctaactaaatggtattgattgt |
24290891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University