View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2159_low_16 (Length: 261)
Name: NF2159_low_16
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2159_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 25132615 - 25132819
Alignment:
| Q |
41 |
gtctctgcttgcaggagctcaaagcctctcactatggctgcaggacctaacatatcccaatacaactttgtcttggaatgtgatccgtggtaagaaagtg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25132615 |
gtctctgcttgcaggagctcaaagcctctcactatggctgcaggacctaacatatcccaatacaactttgtcttggaatgtgatccgtggtaagaaagcg |
25132714 |
T |
|
| Q |
141 |
tgaaagaaaactacatctggattcatattagtcatatactgannnnnnnncttcttcaaggaactggtgtgattacacagaaaatattcaggtcatccag |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25132715 |
tgaaagaaaactacatctggattcatattagtcatatactgattttttttcttcttcaaggaactggtgtgattacacagaaaatattcaggtcatccag |
25132814 |
T |
|
| Q |
241 |
ctatt |
245 |
Q |
| |
|
||||| |
|
|
| T |
25132815 |
ctatt |
25132819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University