View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2159_low_19 (Length: 241)

Name: NF2159_low_19
Description: NF2159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2159_low_19
NF2159_low_19
[»] chr2 (2 HSPs)
chr2 (36-213)||(28216069-28216246)
chr2 (210-241)||(28216017-28216048)
[»] chr4 (1 HSPs)
chr4 (42-80)||(21453239-21453277)
[»] chr3 (1 HSPs)
chr3 (42-83)||(26774263-26774304)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 36 - 213
Target Start/End: Complemental strand, 28216246 - 28216069
Alignment:
36 ttttagttttcattaggtagctcatccttatgatgagtgagtagttcccctagaacatggaaagtatatgacaagttttccataagtgaagaattggagt 135  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28216246 ttttatttttcattaggtagctcatccttatgatgagtgagtagttcccctagaacatggaaagtatatgacaagttttccataagtgaagaattggagt 28216147  T
136 ttaaattttaataatgagaaaaaagatgcatatgtttagaagataaataatcccttaaagagattaatcttacggtta 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
28216146 ttaaattttaataatgagaaaaaagatgcatatgtttagaagataaataatcccttaaagagattaatctcacggtta 28216069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 210 - 241
Target Start/End: Complemental strand, 28216048 - 28216017
Alignment:
210 gttataaaaagaaaatgaggagattcttcatc 241  Q
    ||||||||||||||||||||||||||||||||    
28216048 gttataaaaagaaaatgaggagattcttcatc 28216017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 80
Target Start/End: Original strand, 21453239 - 21453277
Alignment:
42 ttttcattaggtagctcatccttatgatgagtgagtagt 80  Q
    |||||||| |||||||||||||| |||||||||||||||    
21453239 ttttcattgggtagctcatccttgtgatgagtgagtagt 21453277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 83
Target Start/End: Original strand, 26774263 - 26774304
Alignment:
42 ttttcattaggtagctcatccttatgatgagtgagtagttcc 83  Q
    |||||| || |||| |||||||||||||||||||||||||||    
26774263 ttttcactacgtagttcatccttatgatgagtgagtagttcc 26774304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University