View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21600_high_24 (Length: 262)
Name: NF21600_high_24
Description: NF21600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21600_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 136 - 246
Target Start/End: Complemental strand, 45642159 - 45642049
Alignment:
| Q |
136 |
gccataccaatctatgacccaagtatacaatccagaatgcaaattttgtttctaagttctctacagctttccaaatatatgaagattaaaatatgtgagg |
235 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642159 |
gccataccaatctatgagccaagtatacaatccagaatgcaaattttgtttctaagttctctacagctttccaaatatatgaagattaaaatatgtgagg |
45642060 |
T |
|
| Q |
236 |
cattaacatat |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
45642059 |
cattaacatat |
45642049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 45642286 - 45642222
Alignment:
| Q |
9 |
agcagagaacaatagaatactgattgcatagttattatcattggaaccctttaatgtcatcagtc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642286 |
agcagagaacaatagaatactgattgcatagttattatcattggaaccctttaatgtcatcagtc |
45642222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University