View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21600_high_30 (Length: 208)
Name: NF21600_high_30
Description: NF21600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21600_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 41080676 - 41080847
Alignment:
| Q |
18 |
agagaataatgagcaccgatcctccattctgaatctggaactgaaggggaccggtcttagatttgtattgtacatgcttaaannnnnnncaagaagcagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41080676 |
agagaataatgagcaccgatcctccattctgaatctggaactgaaggggaccggtcttagatttgtattgtacatgcttaaa-ttttttcaagaagcagc |
41080774 |
T |
|
| Q |
118 |
atttttatgaggcttgtaattcatagaagtttgcatttcattctttagtcgattgattgtgagcaaggagatg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41080775 |
atttttatgaggcttgtaattcatagaagtttgcatttcattctttagtcaattgattgtgagcaaggagatg |
41080847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 107 - 190
Target Start/End: Original strand, 41103167 - 41103250
Alignment:
| Q |
107 |
caagaagcagcatttttatgaggcttgtaattcatagaagtttgcatttcattctttagtcgattgattgtgagcaaggagatg |
190 |
Q |
| |
|
||||||| |||||||| |||| |||||||||| ||| ||||||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
41103167 |
caagaagtggcatttttgtgagacttgtaattcgtagcagtttgcatttcattctttagtcaagtgattgtgagcagggagatg |
41103250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 119 - 188
Target Start/End: Original strand, 1216545 - 1216614
Alignment:
| Q |
119 |
tttttatgaggcttgtaattcatagaagtttgcatttcattctttagtcgattgattgtgagcaaggaga |
188 |
Q |
| |
|
||||| ||||| ||||||||| ||| | ||||||||| |||||||| || | |||||||||||| ||||| |
|
|
| T |
1216545 |
tttttgtgaggattgtaattcgtagcaatttgcatttaattctttactcaagtgattgtgagcagggaga |
1216614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University