View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21600_low_17 (Length: 323)
Name: NF21600_low_17
Description: NF21600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21600_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 54 - 305
Target Start/End: Complemental strand, 32224496 - 32224245
Alignment:
| Q |
54 |
aagaaggaagatttttgagatgaatagtgatggtagaagatgaagatcttctttgcctagccatccttttcttcctatgaacagttccaaatgcagcagc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224496 |
aagaaggaagatttttgagatgaatagtgatggtagaagatgaagatcttctttgcctagccatccttttcttcctatgaacagttccaaatgcagcagc |
32224397 |
T |
 |
| Q |
154 |
aacaaaaccatgatcatgatggatccgttgacccgacccgttgttgttgtctcctttcacgttgacaaaccctagctcatcttcaacacctgccatgaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224396 |
aacaaaaccatgatcatgatggatccgttgacccgacccgttgttgttgtctcctttcacgttgacaaaccctagctcatcttcaacacctgccatgaaa |
32224297 |
T |
 |
| Q |
254 |
ccacacgcctcggttttctgaaccacaactttcttcttaccttctccctcat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224296 |
ccacacgcctcggttttctgaaccacaactttcttcttaccttctccctcat |
32224245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University