View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21601_high_10 (Length: 395)

Name: NF21601_high_10
Description: NF21601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21601_high_10
NF21601_high_10
[»] chr2 (1 HSPs)
chr2 (1-203)||(9549007-9549211)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 9549007 - 9549211
Alignment:
1 actttccgtctaatttcattgtagttagtgattcaaggcgtcaatgaaacattgtgaggtacgcacatataacttaattatcatctcatatgatctattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9549007 actttccgtctaatttcattgtagttagtgattcaaggcgtcaatgaaacattgtgaggtacgcacatataacttaattatcatctcatatgatctattc 9549106  T
101 aatcttgttatgttggagtaatataaaatctaacaaaataacttattagttttatttgatggggaattaacac--aaacaaaatatcaaaagaacatgtt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
9549107 aatcttgttatgttggagtaatataaaatctaacaaaataacttattagttttatttgatggggaattaacacataaacaaaatatcaaaagaacatgtt 9549206  T
199 ataga 203  Q
    |||||    
9549207 ataga 9549211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University