View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21601_high_13 (Length: 348)
Name: NF21601_high_13
Description: NF21601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21601_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 2 - 244
Target Start/End: Original strand, 2982583 - 2982825
Alignment:
| Q |
2 |
cgacaacgagaacggaaagacatctccggtggtcggagacggaacacgtgctcgccgattgataaaagcattcctgaaaggggtagtcatttctttgatt |
101 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2982583 |
cgacaacgagaacggaaagacgtatccggtggtcggagacggaacacgtgctcgccgattgataaaagcattcctgaaagggggagtcatttctttgatt |
2982682 |
T |
|
| Q |
102 |
gttaacgtggtaagaaaactttcacttttttaaatttctttatggattggattatttatcgtttacattgttgttaatctttcttttctgtttcgcatct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2982683 |
gttaacgtggtaagaaaactttcacttttttaaatttctttatggattggattatttatcgtttacattgttgttaatctttcttttctgtttcgcaact |
2982782 |
T |
|
| Q |
202 |
tttcagatctggaagtgctaccttttccctccatgttcgtatt |
244 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2982783 |
tttccgatctggaagtgctaccttttccctccatgttcgtatt |
2982825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 240 - 333
Target Start/End: Original strand, 2982869 - 2982965
Alignment:
| Q |
240 |
gtattagggtttagggtagtaataatatgtttgtatctaaaccctacgcaagaaaataattaattag---ttattattagcacatggttgtatctaa |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
2982869 |
gtattagggtttagggtagtaataatatgtttgtatctaaaccctaagcaagaaaataattaattagttattattattagtacatggttgtatctaa |
2982965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University