View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21601_high_28 (Length: 233)
Name: NF21601_high_28
Description: NF21601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21601_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 41639167 - 41639379
Alignment:
| Q |
5 |
aaatgtaacaaaatgataatatcacatacctttaattggcttatcaccagaaacccattcgttccatcccttgctacaatcctggcacaacacttttcca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639167 |
aaatgtaacaaaatgataatatcacatacctttaattggcttatcaccagaaacccattcgttccatcccttgctacaatcctggcacaacacttttcca |
41639266 |
T |
|
| Q |
105 |
accacgtgaatgacttgtgctggttcttcccaagctgagactagtatgctattggtggtgcaacagactaccattgcagtgatcatcaatgctattgcaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639267 |
accacgtgaatgacttgtgctggttcttcccaagctgagactagtatgctattggtggtgcaacagactaccattgcagtgatcatcaatgctattgcaa |
41639366 |
T |
|
| Q |
205 |
atgccatctttct |
217 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
41639367 |
atgccatcgttct |
41639379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University