View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21601_low_21 (Length: 304)
Name: NF21601_low_21
Description: NF21601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21601_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 45211775 - 45211488
Alignment:
| Q |
1 |
ttcttctactgttttctcaccaacaaacaaaatgtttttcttccctttccttaaacactgtccatgcatgcttatgttcctcttgtttactttgtttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45211775 |
ttcttctactgttttctcaccaacaaacaaaatgtttttcttccctttccttaatcactgtccatgcatgcttatgttcctcttgtttactttgtttttc |
45211676 |
T |
 |
| Q |
101 |
acttcaacaggttttttcttcttctatttattccttgtgcatgttcctcttgtttacgttgtttgagattgatgtgaatttgtatatatggccggtagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45211675 |
acttcaacaggttttttcttcttctattttttccttgtgcatgttcctcttgtttacgttgtttgagattgatgtgaatttgtatatatggccggtagtt |
45211576 |
T |
 |
| Q |
201 |
atcttgtttcgtcggtatcgaagtaggttttatgatttaattttttgagcctggttttggccgttttcggtttagttgattgccacag |
288 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45211575 |
atcttgtttcgtctgtatcgaagtaggttttatgatttaattttttgagcctggttttggccgttttcggtttagttgattgccacag |
45211488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 5544026 - 5543935
Alignment:
| Q |
22 |
aacaaacaaaatgtttttcttccctttccttaaacactgtccatgcatgcttatgttcctcttgtttactttgtttttcacttcaacaggtt |
113 |
Q |
| |
|
|||||| | |||||| ||| |||||||||||||||| ||||||||||||||| ||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
5544026 |
aacaaaaacaatgttgttcatccctttccttaaacattgtccatgcatgcttttgttcctattgtttacgttgttttacacttcaacaggtt |
5543935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 38 - 113
Target Start/End: Original strand, 5548220 - 5548295
Alignment:
| Q |
38 |
ttcttccctttccttaaacactgtccatgcatgcttatgttcctcttgtttactttgtttttcacttcaacaggtt |
113 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| ||| |||||| | ||||| |||| | |||||||||||||| |
|
|
| T |
5548220 |
ttcttccatttccttaaacattgtccatgcatgtttacgttcctgatatttacactgttctacacttcaacaggtt |
5548295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University