View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21601_low_28 (Length: 241)
Name: NF21601_low_28
Description: NF21601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21601_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 40464718 - 40464920
Alignment:
| Q |
1 |
taaagttataaacagcttttgcgcgtgtgagtgagagagtgatatgagtagggtcttccaaaaatgcatttgtatcagcagggaaagatgtaatgatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464718 |
taaagttataaacagcttttgcgcgtgtgagggagagagtgatatgagtagggtcttccaaaaatgcatttgtatcagcagggaaagatgtaatgatgag |
40464817 |
T |
|
| Q |
101 |
nnnnnnnngaaggtagtggactcaataaataaatgtaactaaaataaattgtcgcacacaaactaaacttaacaatgtagtaaatgaatgtttgaatctc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
40464818 |
-tttttttgaaggtagtggactcaataattaaatgtaactaaaataaattgtcgcacacaaactagacttcacaatgtaacaaatgaatgtttgaatctc |
40464916 |
T |
|
| Q |
201 |
gaat |
204 |
Q |
| |
|
|||| |
|
|
| T |
40464917 |
gaat |
40464920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University