View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21601_low_30 (Length: 226)
Name: NF21601_low_30
Description: NF21601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21601_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 25085231 - 25085036
Alignment:
| Q |
12 |
tgagatgaatatatggatcttcatagtattgaatgtaatgaatttaatgaaatatcatttgcagcatatacataagtttttatgcttgaatatttacatt |
111 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25085231 |
tgagaagaatatatagatcttcatagtattgaatgtaatgaatttaatgaa-tatcatttgcagcatatacataagtttttatgcttgaatatttacatt |
25085133 |
T |
 |
| Q |
112 |
tatagttgtgtacaatatgattattttgattttgttgacaaatactcacccatgatacttcgatacttgtcatctctaatacagaatgccattgagc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25085132 |
tatagttgtgtacaatatgattattttgattttgttgacaaatactcacccatgatacttcgatacttgtcatctctaatacagaatgccattgagc |
25085036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 95
Target Start/End: Complemental strand, 25091346 - 25091304
Alignment:
| Q |
52 |
aatttaatgaaatatcatttgcagcatatacataagtttttatg |
95 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
25091346 |
aatttaatgaa-taccatttgcagcatatacataagtttttatg |
25091304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University