View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21602_high_2 (Length: 290)
Name: NF21602_high_2
Description: NF21602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21602_high_2 |
 |  |
|
| [»] scaffold0421 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0421 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 13 - 140
Target Start/End: Complemental strand, 12350 - 12223
Alignment:
| Q |
13 |
cagaaacgaaataaactgaatcataattctaaatggagtgaattctttggcgtttagatcaagataagaaggaaacatttatgtacctgatctggtaaac |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12350 |
cagaaacaaaataaactgaatcataattctaaatggagtgaattctttggcgtttagatcaagataagaaggaaacatttatgtacctgatctagtaaac |
12251 |
T |
 |
| Q |
113 |
atcctgaacatggcggaaggtagcaaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12250 |
atcctgaacatggcggaaggtagcaaca |
12223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University