View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_high_15 (Length: 318)
Name: NF21603_high_15
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 154 - 245
Target Start/End: Complemental strand, 5519670 - 5519579
Alignment:
| Q |
154 |
tttcttttttcatgtaccaaaaagtttgtttgtttgtttcaaaatattaaaaagagatatatgtagactgcatgcgttttcagtattgttta |
245 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5519670 |
tttcttttttcatgtgccaaaaagtttgtttgtttgtttccaaatattaaaaagagatatatgtagactgcatgcattttcagtattgttta |
5519579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 5519826 - 5519710
Alignment:
| Q |
1 |
cccataggccacccatcaataatcaccaacctaataatccatagtgtataatatt---atttcaggttcacattcaattttgtactaagttgctagcaac |
97 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| | ||| |||||||||||||| |||||||||||||| |
|
|
| T |
5519826 |
cccataggccacccatcaataaccaccaacctaataatccatagtgtataatatttcaggttcatgatcatattcaattttgtaccaagttgctagcaac |
5519727 |
T |
 |
| Q |
98 |
ttatagtaatcacctag |
114 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5519726 |
ttatagtaatcacctag |
5519710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University