View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_high_22 (Length: 260)
Name: NF21603_high_22
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 52183426 - 52183287
Alignment:
| Q |
18 |
gttacctgcaactccgctggacaatgacttttcaaatctgcaacacaacctgcatactgacaatcacctgttcctctggttgcttgtatccctatcccga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183426 |
gttacctgcaactccgctggacaatgactgttcaaatccgcaacacaacctgcatactgacaatcacctgttcctctggttgcttgtatccctatcccga |
52183327 |
T |
|
| Q |
118 |
cattgtaaccatccaccaaactaacgtcatagaagtcttt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183326 |
cattgtaaccatccaccaaactaacgtcatagaagtcttt |
52183287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 152 - 259
Target Start/End: Original strand, 52183100 - 52183207
Alignment:
| Q |
152 |
gtcttttgacgtcactgctccgccaggctggtctggacgtttctggggtagaaccggctgcaacttcgacggtgctggtaacgggaattgcatcaccgga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183100 |
gtcttttgacgtcactgctccgccaggctggtctggacgtttctggggtagaaccggctgcaacttcgacggtgctggtaacgggaattgcatcaccgga |
52183199 |
T |
|
| Q |
252 |
gactgcac |
259 |
Q |
| |
|
|||||||| |
|
|
| T |
52183200 |
gactgcac |
52183207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University