View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_high_30 (Length: 201)
Name: NF21603_high_30
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 15 - 153
Target Start/End: Original strand, 38954434 - 38954568
Alignment:
| Q |
15 |
cataggacatttatatctttaaaacaatgaagcaaaagaaatgacaatctcctgcttctacttagcataaaataaaatgacaacaattatgtttggagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38954434 |
cataggacatttatatctttaaaacaatgaagcaaaagaaatgacaatctcctgcttctacttagcat----taaaatgacaacaattatgtttggagct |
38954529 |
T |
|
| Q |
115 |
caaccaagccggtacacataaataaaaactcagtttccc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38954530 |
caaccaagccggtacacataaataaaaactcagcttccc |
38954568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University