View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_low_11 (Length: 366)
Name: NF21603_low_11
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 114 - 365
Target Start/End: Original strand, 52182956 - 52183207
Alignment:
| Q |
114 |
tatggttttatttgcaggtaatgtagcttcggggacaatgtttaccatagaaaaccgttgcaacaacacaatctggccgggaacactttctggcaaccgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52182956 |
tatggttttatttgcaggtaatgtagcttcggggacaatgtttaccatagaaaaccgttgcaacaacacaatctggccgggaacactttctggcaacggt |
52183055 |
T |
 |
| Q |
214 |
gctgaacttctcggcgacgggggattttctctgccgcaaggatcgtcttttgacgtcactgctccgccaggctggtctggacgtttctggggtagaaccg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183056 |
gctgaacttctcggcgacgggggattttctctgccgccaggatcgtcttttgacgtcactgctccgccaggctggtctggacgtttctggggtagaaccg |
52183155 |
T |
 |
| Q |
314 |
gctgcaacttcgacggtgctggtaacgggaattgcatcaccggagactgcac |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183156 |
gctgcaacttcgacggtgctggtaacgggaattgcatcaccggagactgcac |
52183207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 14 - 79
Target Start/End: Original strand, 52182862 - 52182927
Alignment:
| Q |
14 |
tcatcatccttctgctgcttctactaggtgaacaagaaatttaacactgattttacgttccatgtc |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52182862 |
tcatcatccttctgctgcttctactaggtgaacaagaaatttaacactgattttacgttccatgtc |
52182927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University