View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_low_14 (Length: 324)
Name: NF21603_low_14
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 134 - 315
Target Start/End: Original strand, 41315263 - 41315444
Alignment:
| Q |
134 |
agaaatttatcaagattagagagatgtaacttggtggaagaaagtggtttacgaggtgggagttggttgttaatggaagaggatgatcggcatgtgaagg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41315263 |
agaaatttatcaagattagagagatgtaacttggtggaagaaagtggtttacgaggtgggagttggttattaatggaagaggatgatcggcatgtgaagg |
41315362 |
T |
|
| Q |
234 |
tggattgttgtctagtttggaacatgttaaggttgtttgatggtacatttgaattgatcatcataattgtgaagacagacag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
41315363 |
tggattgttgtctagtttggaacatgttaaggttgtgtgatggtagagttgaattgatcatcataatgttgaagacagacag |
41315444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 41315115 - 41315200
Alignment:
| Q |
1 |
ttgatcatctattgttttcttatccgatgaccataagtttgatagatcaagattttctaaaatgttctttgttttcttctcaacta |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41315115 |
ttgatcatctattgttttcttatccgatgaccataagtttgatagatcaagattttctaaaatgttctttgttttcttctcaacta |
41315200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University