View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_low_23 (Length: 248)
Name: NF21603_low_23
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 21 - 123
Target Start/End: Original strand, 39154722 - 39154824
Alignment:
| Q |
21 |
ttgggttggaagtgttctggttaggaccaaaggagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggattgtgagtatcttcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39154722 |
ttgggttggaagtgttctggttaggaccaaaggagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggattgtgagtatcttcc |
39154821 |
T |
|
| Q |
121 |
gcc |
123 |
Q |
| |
|
||| |
|
|
| T |
39154822 |
gcc |
39154824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 176 - 238
Target Start/End: Original strand, 39154878 - 39154940
Alignment:
| Q |
176 |
aagaaaaagactcttgcaaaaacatgttcataatatttgaaatttactatatgcaggtctctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39154878 |
aagaaaaagactcttgcaaaaacatgttcataatatttgaaatttactatatgcaggtctctg |
39154940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 21 - 119
Target Start/End: Original strand, 29125564 - 29125662
Alignment:
| Q |
21 |
ttgggttggaagtgttctggttaggaccaaaggagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggattgtgagtatcttc |
119 |
Q |
| |
|
||||||||| ||| ||||||| |||||||| ||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29125564 |
ttgggttgggagttttctggtcaggaccaacggagaaaagggtggccaagtgttttgtgctgaaatatgtattatttggagaggattgtaagtatcttc |
29125662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 21 - 107
Target Start/End: Complemental strand, 32743425 - 32743337
Alignment:
| Q |
21 |
ttgggttggaagtgttctggttaggaccaaaggaga--aaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggatt |
107 |
Q |
| |
|
|||| |||| ||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
32743425 |
ttggattgggagtgttctggtcaggaccaaaggagagaaaagggtggcaatgtgttttgtgctgaaatatgtattatctggagaggatt |
32743337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University