View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_low_27 (Length: 210)
Name: NF21603_low_27
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 14 - 138
Target Start/End: Complemental strand, 54609508 - 54609390
Alignment:
| Q |
14 |
aatatatggtcaaattttatggggaagatgctttgaaataagttaaaatcatgcaaatacgtgaactctaggtcatttcactgacactatatatgtatac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54609508 |
aatatatggtcaaattttatggggaagatgctttgaaataagttaaaatcatgcaaatacgtgaactctaggtcatttcactgacac------tgtatac |
54609415 |
T |
 |
| Q |
114 |
aaggaaaagaaatcactcattttgt |
138 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
54609414 |
aaggaaaagaaatcactcattttgt |
54609390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University