View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21603_low_9 (Length: 416)
Name: NF21603_low_9
Description: NF21603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21603_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 3e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 286 - 399
Target Start/End: Complemental strand, 40005844 - 40005731
Alignment:
| Q |
286 |
tatatctatcaacctccaagtttagtcttgtccttctccaacttttcaaagaaaccagtaagagctttcaatgctttgacttgatactgcaaagcaacaa |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40005844 |
tatatctatcaacctccaagtttagtcttgtccttctccaacttttcaaagaaaccagtaagagctttcaatgctttgacttgatactgtaaagcaacaa |
40005745 |
T |
 |
| Q |
386 |
tatagccagcagtt |
399 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40005744 |
tatagccagcagtt |
40005731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 40006064 - 40006014
Alignment:
| Q |
64 |
tctaagaaatgggaaatatttttcttgatcccaattaaccaaaagtacaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006064 |
tctaagaaatgggaaatatttttcttgatcccaattaaccaaaagtacaac |
40006014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 202 - 232
Target Start/End: Complemental strand, 40005928 - 40005898
Alignment:
| Q |
202 |
gaacctctctaacctaaggaattcattccat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40005928 |
gaacctctctaacctaaggaattcattccat |
40005898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University