View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21605_low_7 (Length: 224)
Name: NF21605_low_7
Description: NF21605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21605_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 4459639 - 4459504
Alignment:
| Q |
1 |
ttagtgtttgtatgtggtgacctcccatatgagtccatctatgcc--cgcaaactcttgcagattttaggttgttttcaatattgggtggtttcgatttt |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4459639 |
ttagtgtttgaatgtggtgacctcccatatgagtccatctatgtcaccgcaaactcttgcagattttaggttgttttcaattttgggtggtttcgatttt |
4459540 |
T |
|
| Q |
99 |
gaattgttttcgagttgtgtcccttttcgatatata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4459539 |
gaattgttttcgagttgtgtcccttttcgatatata |
4459504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 205
Target Start/End: Original strand, 4459793 - 4459826
Alignment:
| Q |
172 |
tcaatgtcaagtaaacttcaacagattgcaaact |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
4459793 |
tcaatgtcgagtaaacttcaacagattgcaaact |
4459826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University