View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21606_high_11 (Length: 222)
Name: NF21606_high_11
Description: NF21606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21606_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 19974460 - 19974357
Alignment:
| Q |
15 |
taatactgccgataatcaagctaagctcaaggatttttcaagtcatcataatgatgcaaccttgtatgtttcgtgtgct-----tttgtctatttaattc |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
19974460 |
taatactgccgataatcaggctaagctcaaggatttttcaagtcatcataatgatgtaaccttgtatgtatcgtgtgctcacagtttgtctatttaattc |
19974361 |
T |
 |
| Q |
110 |
ccct |
113 |
Q |
| |
|
|||| |
|
|
| T |
19974360 |
ccct |
19974357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 135 - 205
Target Start/End: Complemental strand, 19974300 - 19974230
Alignment:
| Q |
135 |
accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacaaactgtttagaaacaaaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
19974300 |
accttatgccttttccttttaaaagaaagaaagaaaagtcccttatttacacactttttagaaacaaaaat |
19974230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University