View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21606_high_12 (Length: 210)
Name: NF21606_high_12
Description: NF21606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21606_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 41 - 165
Target Start/End: Complemental strand, 10100880 - 10100756
Alignment:
| Q |
41 |
aaattgaggctataaggttaaattttcctcataatctcatttctcttcctgtagtgttgttttccattctctcatttttgtttcattgaatgtttaaccc |
140 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||| ||| |||||||||| |||||| |||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
10100880 |
aaattgaggctataagcttaaatttttctcataacctcctttctcttccggtagtgctgttttccattctctcatttttgtttcactgagtgtttaaccc |
10100781 |
T |
|
| Q |
141 |
ttattacattagatgcatttctatg |
165 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
10100780 |
ttattacattagatgcatttttatg |
10100756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 10082939 - 10082892
Alignment:
| Q |
41 |
aaattgaggctataaggttaaattttcctcataatctcatttctcttc |
88 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
10082939 |
aaattgaagctataaggttaaattttccttataatctcctttctcttc |
10082892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University