View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21606_low_10 (Length: 256)
Name: NF21606_low_10
Description: NF21606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21606_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 256
Target Start/End: Complemental strand, 40776374 - 40776130
Alignment:
| Q |
13 |
tagattattctgtttgttgctagagatagagaaagtgcatagctttttccatgtgtgttaggttgccactcattcctcatcaaatttcaaa-ggggaaat |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40776374 |
tagatttttctgtttgttgctagagatagagaaagtgcatagctttttccatgtgtgttaggttgccactcattcctcatcaaatttcaaaaggggaaat |
40776275 |
T |
|
| Q |
112 |
ggacaagctagttcaactcaacgagattttacgtccacaaaaaattcatataattttcacgaaaaacaattatattgttgtgaaagataggatttacgtg |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40776274 |
ggacaagctagttcaacgcaacgagatttcaagtccacaaaaaattcatataattttaacgaaaaataattatattgttgtgaaagataggatttacgtg |
40776175 |
T |
|
| Q |
212 |
tatttattttaacgcatcannnnnnncttcttgtgcaagtttaac |
256 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40776174 |
tatttattttaacgcatcatttttttcttcttgtgcaagtttaac |
40776130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University