View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21606_low_11 (Length: 223)
Name: NF21606_low_11
Description: NF21606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21606_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 152 - 222
Target Start/End: Complemental strand, 43017127 - 43017057
Alignment:
| Q |
152 |
tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgaggattctacaaccacaatgtca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43017127 |
tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgatgattctacaaccacaatgtca |
43017057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 43017181 - 43017130
Alignment:
| Q |
29 |
actggaaagaacaggttgtgaatttaaagaaatcatggagtaaaagtagttc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43017181 |
actggaaagaacaggttgtgaatttaaagaaatcatgaagtaaaaatagttc |
43017130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University