View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21606_low_4 (Length: 342)
Name: NF21606_low_4
Description: NF21606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21606_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 10 - 338
Target Start/End: Original strand, 25771993 - 25772320
Alignment:
| Q |
10 |
cggaagaatgaactaattattaggggaattaagtgttgtgggtgcctccgcgagatatatcggatcattgcactttggtgttaaaggtgaataattgtta |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25771993 |
cggaagaatgaattaattattaggggaattaagtgttgtgggtgcctccgcgagatatatcggatcattgttctttggtgttaaaggtgaataattgtta |
25772092 |
T |
|
| Q |
110 |
aagagggagacatggggaatcccaccactgtgaggcaaaaggaggtaggctttgtccatagccagagcattggcaacttggttgccctccctatagtgaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25772093 |
aagagggagacatggggaatcccaccactttgaggcaaaaggaggtacgctttgtccatagcctgagcattggcaacttggttgccctccctatagtgaa |
25772192 |
T |
|
| Q |
210 |
cttaaggtnnnnnnntgtttgggtggagtctccaaccgaggttaggcgggcggtgatggattatttttccaatcaagcggcagacacactgtggttgtgg |
309 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25772193 |
cttaaggt-ggggggtgtttgggtggagtctccaacctaggttaggcgggcggtgatggattatttttctaatcaagtggcagacacactgtggttgtgg |
25772291 |
T |
|
| Q |
310 |
cccacttttggatagggtaaccttttcta |
338 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
25772292 |
cccacttttggatagcgtaaccttttcta |
25772320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University