View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21606_low_7 (Length: 311)
Name: NF21606_low_7
Description: NF21606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21606_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 40557128 - 40557424
Alignment:
| Q |
1 |
gaattgtctttggattatgtgcctcaaaagaaaaaagggaggaagaagatcgtcggtatgcacgtgtccgtgttggatcccaatcttatactctacaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40557128 |
gaattgtctttggattatgtgcctcaaaataaaaaagggaggaagaagattgttggtatgcccgtgttcgtgttggatcccaatcttatactctacaaag |
40557227 |
T |
 |
| Q |
101 |
acatgtgcttcaagaagtggaaaatggtgactggagaggtctacattatcacaaacaaatggaacgaacttgtagcagaaaaccgtttcaaagccaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557228 |
acatgtgcttcaagaagtggaaaatggtgactggagaggtctacattatcacaaacaaatggaacgaacttgtagcagaaaaccgtttcaaagccaagaa |
40557327 |
T |
 |
| Q |
201 |
aaaggtgcaactctggtcttttagatgccgtggtgaactctacttcgcactcgtcaagctctagccaagttctattagtcaatgatgcacatacttt |
297 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40557328 |
aaaggtgcaactttggtcttttagatgccgtggtgaactctacttcgcactcgtcaagctctagccaagttctatcagtcaatgatgcacatacttt |
40557424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University