View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21607_high_6 (Length: 207)
Name: NF21607_high_6
Description: NF21607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21607_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 38426418 - 38426233
Alignment:
| Q |
7 |
acatcatcaccatcacttcttaactatgtaagtactcttttcttatactttttcatttgagtttatctaatatgagtgtgaatttctccttagtttgctt |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38426418 |
acatcatcac-atcacttcttaactatgtaagtactcttttcttatactttttcatttgagtttatctaatatgagtgtgagtttctccttagtttgctt |
38426320 |
T |
 |
| Q |
107 |
ccaaaaatttacaagttaataatgattcatcaaaagttcaaatttatcatgctgtaagattaataaagattaaatcttggttccaac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38426319 |
ccaaaaatttacaagttaataatgattcatcaaaagttcaaatttatcatgctgtaagattaataaagattaaatcttggttccaac |
38426233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University