View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21607_low_5 (Length: 226)
Name: NF21607_low_5
Description: NF21607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21607_low_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 76 - 226
Target Start/End: Original strand, 8403006 - 8403156
Alignment:
| Q |
76 |
gtaattagagaatgggattaggattgtttaaggcgtttttctgttgtactactaaccgagacattcccattgtctcctcttcggagtcctctcccaggca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8403006 |
gtaattagagaatgggattaggattgtttaaggcgtttttctgttgtactacaaaccgagacattcccattgtctcctcttcggagtcctctcccaggca |
8403105 |
T |
|
| Q |
176 |
tagctctggctatggctacaatcaaacaagttttgatccatctcccaaaac |
226 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8403106 |
tagctctggctatggctacaatcaaccaagttttgatccatctcccaaaac |
8403156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 8402953 - 8402995
Alignment:
| Q |
6 |
atatataggtttggaaacatatgttaaatgggaaagcaactag |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402953 |
atatataggtttggaaacatatgttaaatgggaaagcaactag |
8402995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University