View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_high_18 (Length: 263)
Name: NF21608_high_18
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 688686 - 688956
Alignment:
| Q |
1 |
ggtacaccttaagccacatgccatgatgacttcttcaattcacaaatgagcttgaaaatgaattattgggaggacaatatgtttagaaggtagctcattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
688686 |
ggtacaccttaagccacatgccatgatgacttcttcaattcacaaatgagcttgaaaatgaattattaggaggacagtatgtttagaaggtagctcattt |
688785 |
T |
|
| Q |
101 |
tgcataatatttataggaatagctgtca--------gtatgtatgtttagtagtgattgtattttttg-----------atgagtaattaattagtttta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
688786 |
tgcataatatttataggaatagctgtcagtatgtatgtatgtatgtttagtagtgattgtattttttgatgagaaatcaatgagtaattaattagtttta |
688885 |
T |
|
| Q |
182 |
atagtaattttataattaagtttggggatgaaaactatgaattagacggctgcatggtatttgtctttcatc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
688886 |
atagtaattttataattaagtttggggatgaaaactatgaattagacggctgcatggta-ttgtctttcatc |
688956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University