View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_11 (Length: 372)
Name: NF21608_low_11
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 20 - 362
Target Start/End: Complemental strand, 31792422 - 31792080
Alignment:
| Q |
20 |
aaaccaacagtcaaccttcagttgggacatccattttccgagtctgggaatgaaacatttcaactatatcagcagcagtgctgcattcgtctgggtttct |
119 |
Q |
| |
|
||||||||| |||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792422 |
aaaccaacaatcaatcttcaatttggacatccattttccgagtctgggaatgaaacatttcaactatatcagcagcagtgctgcattcgtctgggtttct |
31792323 |
T |
 |
| Q |
120 |
gtctggcactctgcaaataaatcttggaaatctgatagagatgcctctagaaggatgaaccaaaccaatggcagcatggtgaactggggatactgtaaag |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792322 |
gtctgacactctgcaaataaatcttggaaatctgatagagatgcctctagaaggatgaaccaaaccaatggcagcatggtgaactggggatactgtaaag |
31792223 |
T |
 |
| Q |
220 |
tctgcacctcttatttcccaaacaagttgtggacaaaaccacatgtctggtgtctctcctgtttgataatatggcggcttttttgacaacaatttgtcct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792222 |
tctgcacctcttatttcccaaacaagttgtggacaaaaccacatgtctggtgtctctcctgtttgataatatggcggcttttttgacaacaatttgtcct |
31792123 |
T |
 |
| Q |
320 |
cagataagaattctttcatctgcatcacaatgtcaatattcat |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792122 |
cagataagaattctttcatctgcatcacaatgtcaatattcat |
31792080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University