View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_14 (Length: 332)
Name: NF21608_low_14
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 152 - 325
Target Start/End: Complemental strand, 39370437 - 39370264
Alignment:
| Q |
152 |
gggtttgcaattttgttcttatatcattcaggttgagtaataaatttttattgagnnnnnnnncccttgtgtggagattttctctggttgctttacaaac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
39370437 |
gggtttgcaattttgttcttatatcattcaggttgagtaataaatttttattgagttttttttcccttgtgtgaagattttctcaggttgctttacaaac |
39370338 |
T |
 |
| Q |
252 |
aattcttcaccaaagaaaggagaaaaaagttggcttgatagttcaggtgggggagtggggtatgatgatgtcca |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
39370337 |
aattcttcaccaaagaaaggagaaaaaagttggcttgatagttcaggtgggggagtggggtataatgaggtcca |
39370264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 39370485 - 39370616
Alignment:
| Q |
1 |
agagttgttgtggtgaagaaaactcagtatgactccatatttatattaactctctacttttgtttcttccaactattctcatgaatcataacaaatcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39370485 |
agagttgttgtggtgaagaaaactcagtatgactccatatttatattaactctctacttttgtttcttccaactattctcatgaatcataacaaatcaca |
39370584 |
T |
 |
| Q |
101 |
tctacagaatgaactctcttcaatttttctgt |
132 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
39370585 |
tctacagaatgaactctcttcaacttttctgt |
39370616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University