View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_16 (Length: 319)
Name: NF21608_low_16
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 308
Target Start/End: Complemental strand, 2176041 - 2175741
Alignment:
| Q |
18 |
cttttggatctgggtctccttatgctgttgggattgttaatattattaaagcgttttatggaaggagtatttcttttcatgctgcttggcttctcattat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176041 |
cttttggatctgggtctccttatgctgttgggattgttaatattattaaagcgttttatggaaggagtatttcttttcatgctgcttggcttctcattat |
2175942 |
T |
|
| Q |
118 |
caccactcaggtgaggtttcttttcttgatgctaattattgatagttgtaattttgaaaatcataatctcattatcttcttat----------aagctcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
2175941 |
caccactcaggtgaggtttcttttcttgatgctaattattgttagttgtaattttgaaaatcataatctcattatcttcttttttaagctctagagctcg |
2175842 |
T |
|
| Q |
208 |
ttaaatgttgagaagtgataaattgcaaattcaaacatatgtcaaatcatatcatagatatttactattatcttttaccatctaaaatgtatttatctca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2175841 |
ttaaatgttgagaagtgataaattgcaaattcaaacatatgtcaaatcatattatagatatttacaattatcttttaccatctaaaatgtatttatctca |
2175742 |
T |
|
| Q |
308 |
t |
308 |
Q |
| |
|
| |
|
|
| T |
2175741 |
t |
2175741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 36 - 130
Target Start/End: Original strand, 36900351 - 36900445
Alignment:
| Q |
36 |
cttatgctgttgggattgttaatattattaaagcgttttatggaaggagtatttcttttcatgctgcttggcttctcattatcaccactcaggtg |
130 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||| |||||||||||||||| ||| || |||| |||||| |||||||| ||||| || ||||||||| |
|
|
| T |
36900351 |
cttatgctgttggtattgtgaatatcattaaggcgttttatggaaggaatatatcgtttcttgctgcatggcttctgattattacgactcaggtg |
36900445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University