View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21608_low_18 (Length: 291)
Name: NF21608_low_18
Description: NF21608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21608_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 111 - 284
Target Start/End: Complemental strand, 39370437 - 39370264
Alignment:
| Q |
111 |
gggtttgcaattttgttcttatatcattcaggttgagtaataaatttttattgagnnnnnnnncccttgtgtggagattttctctggttgctttacaaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
39370437 |
gggtttgcaattttgttcttatatcattcaggttgagtaataaatttttattgagttttttttcccttgtgtgaagattttctcaggttgctttacaaac |
39370338 |
T |
|
| Q |
211 |
aattcttcaccaaagaaaggagaaaaaagttggcttgatagttcaggtgggggagtggggtatgatgatgtcca |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
39370337 |
aattcttcaccaaagaaaggagaaaaaagttggcttgatagttcaggtgggggagtggggtataatgaggtcca |
39370264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 39370509 - 39370424
Alignment:
| Q |
1 |
gagttttcttcaccacaacaactctagtctattttggtgcattgggagcttggataattgtgtatcttgagggggtttgcaatttt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39370509 |
gagttttcttcaccacaacaactctagtctattttggtgcattgggagcttggataattgtgtatcttgatggggtttgcaatttt |
39370424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 125
Target Start/End: Complemental strand, 32496767 - 32496719
Alignment:
| Q |
76 |
tttgcaatttttctgtgcacaaattgtaattgagagggtttgcaattttg |
125 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
32496767 |
tttgcaatttctctgtgcaaaaattataattgaga-ggtttgcaattttg |
32496719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 3511752 - 3511669
Alignment:
| Q |
1 |
gagttttcttcaccacaacaactctagtctattttggtgcattgggagcttggataattgtgtatcttgagggggtttgcaatttt |
86 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| |||| |||||| | |||| || |||||| ||||||| | |||||||||||| |
|
|
| T |
3511752 |
gagttttcatcaccacaacaactctagtct-tttgggtgtattggg-gattgggtagttgtgtgtcttgagagagtttgcaatttt |
3511669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 133
Target Start/End: Complemental strand, 37883075 - 37883016
Alignment:
| Q |
73 |
gggtttgcaatttttctgtgcacaaattgtaattgagagggtttgcaattttgttcttata |
133 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
37883075 |
gggtttgcaatttttccatgcaaaaattgtaatcgaga-ggtttgcaattttgtccttata |
37883016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 124
Target Start/End: Complemental strand, 9687552 - 9687435
Alignment:
| Q |
4 |
ttttcttcaccacaacaactctagtctattttggtgcattgggagcttggataattgtgtatcttgagggggtttgcaatttttctgtgcacaaattgta |
103 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||| ||| ||| || ||||| ||| |||||| ||||||| |||||||||||||| | |||| | || || |
|
|
| T |
9687552 |
ttttctttaccacaacagctctagtct-tttgggtatattagg-gcttgaatagttgtgtgtcttgagagggtttgcaattttcca-tgcaaagatatta |
9687456 |
T |
|
| Q |
104 |
attgagagggtttgcaatttt |
124 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9687455 |
attgagagggtttgcaatttt |
9687435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 122
Target Start/End: Complemental strand, 27049043 - 27048996
Alignment:
| Q |
74 |
ggtttgcaatttttctgtgcacaaattgtaattgagagggtttgcaatt |
122 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||| ||||||||||| |
|
|
| T |
27049043 |
ggtttgcaatttttccgtgcaaaaattgcaattgaga-ggtttgcaatt |
27048996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University